Selective DNA intercalation of massive molecules as a new method of highly specific inhibition of transcription

The possibility of precise external control of transcription opens up many prospects. One of them is dealing with disorders based on enhanced transcription of a certain part of the genome or its mutant fragment. Therefore, the aim of our study is to prove the fundamental possibility of developing DNA-intercalators capable of highly specific binding to certain pre-selected areas of DNA by using a number of in silico methods.

A positively charged bis-intercalator - XR5944 (PDB ID: 2MG8) was chosen as the basis. The target 50-nucleotide DNA duplex (TGGAGGTAGTAAGACCTCCCTTTACAACCTCAGGCGAGGAATTGCCCTTG), which is part of the viral (EBV) protein EBNA1 gene, was generated using the Avogadro program. Preliminary intercalation of XR5944 was performed in the same program. Then by manual modification and analysis of the data on the molecular dynamics, the structure of the DNA-intercalator was selected. All simulations were performed for 50 ns in the GROMACS software package, using an explicit solvent (TIP3P) and at physiological ionic strength. The force field AMBER was used. Ligand parameterization was performed using ACPYPE Server.

Thus, we developed a structural model of the DNA-intercalator that during a molecular dynamic experiment, along with constant intercalation, selectively recognized the nucleotide sequence of the DNA duplex. This process is based on the specific placement of the hydrogen bond donors and acceptors directed to each pair of nitrogen bases in the direction of the large DNA furrow.

So, we have proved the possibility of developing substances – DNA-intercalators – that can bind highly specifically to certain pre-selected areas of DNA.